Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circ_102610 | |||
Gene | Organism | Human | |
Genome Locus | Build | hg19 | |
Disease | Crohn Disease | ICD-10 | Crohn disease [regional enteritis] (K50) |
DBLink | PMID | 31261517 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | 5 patients of CD and 5 healthy controls |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward ACAGTGTGCCAAGTTACTCG ReverseAGTGCAAGATAAAGGCCCAA | Statistics | Fold Change : Upregulated pvalue : <0.05 |
Citation | |||
Yin, J, Hu, T, Xu, L, Li, P, Li, M, Ye, Y, Pang, Z (2019). Circular RNA expression profile in peripheral blood mononuclear cells from Crohn disease patients. Medicine (Baltimore), 98, 26:e16072. |